Review



2011 addgene plasmid 44012 software  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc 2011 addgene plasmid 44012 software
    2011 Addgene Plasmid 44012 Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 372 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2011+addgene+plasmid+44012+software/pInducer20+(Plasmid+%2344012)/pm30244869-237-152-153
    Average 96 stars, based on 372 article reviews
    2011 addgene plasmid 44012 software - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: Esophageal Organoids from Human Pluripotent Stem Cells Delineate Sox2 Functions during Esophageal Specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Activin A Cell Guidance Systems Cat#GFH6 CHIR99021 Stemgent Cat#04-0004 BIO Tocris Cat#3194 Y-27632 dihydrochloride Tocris Cat#1254 SB431542 Tocris Cat#1614 Doxycycline Sigma-Aldrich Cat#D3447 Tamoxifen Sigma-Aldrich Cat#T5648 hESC-qualified Matrigel BD Biosciences Cat#354277 mTeSR1 media Stem Cell Technologies Cat#5850 Advanced DMEM:F12 Thermo Fisher Scientfic Cat#12634-010 Matrigel BD Biosciences Cat#354234 Defined fetal bovine serum (dFBS) Hyclone Cat#SH30070.02 Proteinase K Thermo Fisher Scientifc Cat#AM2548 Normal donkey serum Jackson Immunoresearch Labs Cat#017-000-121 Heat-inactivated lamb serum GIBCO Cat#16070096 Blocking Reagent Sigma-Aldrich Cat#11096176001 L-glutamine (100x) Thermo Fisher Scientific Cat#25030-081 Pen/Strep (100x) Thermo Fisher Scientific Cat#15140-122 50x B27 supplement w/o Vitamin A Thermo Fisher Scientific Cat#12587-010 Non-essential Amino Acids (100x) Thermo Fisher Scientific Cat#11140050 HEPES Buffer Thermo Fisher Scientific Cat#15630080 N2 Supplement Thermo Fisher Scientific Cat#17502-048 Dispase Thermo Fisher Scientific Cat#17105-041 Acutase Thermo Fisher Scientific Cat#A11105-01 Collagen Type I, rat tail EMD Millipore Cat#08-115 Transwell 24mm Polyester Membrane Inserts, 6 well plate Corning Cat#3450 Deep Well Plate, 6 well BD Cat#355467 Ahlstrom Filter Papers – Grade 222 Fisher Scientific Cat#09-790-49J 1,2-Dioctanoyl-sn-glycerol Cayman Chemicals Cat#62225 F12 Media Invitrogen Cat#11765-054 1x DMEM Invitrogen Cat#11965-084 Fetal Bovine Serum (FBS) HyClone Cat#SH30071.03 Adenine Sigma-Aldrich Cat#A2786-5G Cholera toxin EMD Millipore Cat#227035 Hydrocortisone Sigma-Aldrich Cat#H0888-1G Fungizone (Amphotericin B) Omega Scientific Cat#FG-70 Insulin, human recombinant Invitrogen Cat#12585-014 EGF Sigma-Aldrich Cat#1257-0.1MG RNAlater Thermo Fisher Scientific Cat#AM7020 Critical Commercial Assays Quantitect SYBR Green QIAGEN Cat#204145 Nucleospin RNA Macherey-Nagel Cat#740955 SuperScript VILO cDNA synthesis kit Thermo Fisher Scientific Cat#11754250 Click-iT EdU Alexa Fluor 488 Imaging Kit Invitrogen Cat#C10337 Deposited Data Raw and analyzed RNA-seq data This paper GSE112886 (Continued on next page) Cell Stem Cell 23, 501–515.e1–e7, October 4, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: H1 ES cells (passage 42) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: H9 ES cells (passage 30) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0062 Human: iPS65.8 iPS cells (passage 44) CCHMC Pluripotent Stem cell core N/A Human: iPS72.3 iPS cells (passage 35) CCHMC Pluripotent Stem cell core N/A Human: iPS263.10 iPS cells (passage 30) N/A N/A Human: WTC CRISPRi-SOX2 iPS cells (passage 43) Conklin lab Mandegar et al., 2016 Experimental Models: Organisms/Strains Mouse: Foxa2tm2.1(cre/Esr1*)Moon/J The Jackson Laboratory JAX: 008464 Mouse: B6;129S-Sox2tm1(cre/ERT2)Hoch/J The Jackson Laboratory JAX: 017593 Mouse: Sox2tm1.1Lan/J Lang Lab (JAX: 013093) Xenopus laevis N/A N/A Oligonucleotides sox2- UTR MO: CTGGCAGAGCGGAATCAGTTTCCCA GeneTools N/A (synthesized) sox2- ATG MO: AGCTCGGTCTCCATCATGCTGTAC GeneTools N/A (synthesized) control MO: CCTCTTACCTCAGTTACAATTTATA GeneTools N/A (synthesized) See Table S1 for qRT-PCR primers IDT DNA N/A (synthesized) Recombinant DNA pINDUCER20 Meerbrey et al., 2011 Addgene plasmid 44012 Software and Algorithms Imaris Bitplane N/A NIS Elements Nikon N/A Computational Suite for Bioinformaticians and Biologists version 2.1 (CSBB v2.1) N/A https://sourceforge.net/projects/ csbb-v2-1/ Gene Set Enrichment Analysis (GSEA) N/A Subramanian et al., 2005 PRISMv6 graphing and statistical software GraphPad Software N/A ..

    Control:

    Article Title: Esophageal Organoids from Human Pluripotent Stem Cells Delineate Sox2 Functions during Esophageal Specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Activin A Cell Guidance Systems Cat#GFH6 CHIR99021 Stemgent Cat#04-0004 BIO Tocris Cat#3194 Y-27632 dihydrochloride Tocris Cat#1254 SB431542 Tocris Cat#1614 Doxycycline Sigma-Aldrich Cat#D3447 Tamoxifen Sigma-Aldrich Cat#T5648 hESC-qualified Matrigel BD Biosciences Cat#354277 mTeSR1 media Stem Cell Technologies Cat#5850 Advanced DMEM:F12 Thermo Fisher Scientfic Cat#12634-010 Matrigel BD Biosciences Cat#354234 Defined fetal bovine serum (dFBS) Hyclone Cat#SH30070.02 Proteinase K Thermo Fisher Scientifc Cat#AM2548 Normal donkey serum Jackson Immunoresearch Labs Cat#017-000-121 Heat-inactivated lamb serum GIBCO Cat#16070096 Blocking Reagent Sigma-Aldrich Cat#11096176001 L-glutamine (100x) Thermo Fisher Scientific Cat#25030-081 Pen/Strep (100x) Thermo Fisher Scientific Cat#15140-122 50x B27 supplement w/o Vitamin A Thermo Fisher Scientific Cat#12587-010 Non-essential Amino Acids (100x) Thermo Fisher Scientific Cat#11140050 HEPES Buffer Thermo Fisher Scientific Cat#15630080 N2 Supplement Thermo Fisher Scientific Cat#17502-048 Dispase Thermo Fisher Scientific Cat#17105-041 Acutase Thermo Fisher Scientific Cat#A11105-01 Collagen Type I, rat tail EMD Millipore Cat#08-115 Transwell 24mm Polyester Membrane Inserts, 6 well plate Corning Cat#3450 Deep Well Plate, 6 well BD Cat#355467 Ahlstrom Filter Papers – Grade 222 Fisher Scientific Cat#09-790-49J 1,2-Dioctanoyl-sn-glycerol Cayman Chemicals Cat#62225 F12 Media Invitrogen Cat#11765-054 1x DMEM Invitrogen Cat#11965-084 Fetal Bovine Serum (FBS) HyClone Cat#SH30071.03 Adenine Sigma-Aldrich Cat#A2786-5G Cholera toxin EMD Millipore Cat#227035 Hydrocortisone Sigma-Aldrich Cat#H0888-1G Fungizone (Amphotericin B) Omega Scientific Cat#FG-70 Insulin, human recombinant Invitrogen Cat#12585-014 EGF Sigma-Aldrich Cat#1257-0.1MG RNAlater Thermo Fisher Scientific Cat#AM7020 Critical Commercial Assays Quantitect SYBR Green QIAGEN Cat#204145 Nucleospin RNA Macherey-Nagel Cat#740955 SuperScript VILO cDNA synthesis kit Thermo Fisher Scientific Cat#11754250 Click-iT EdU Alexa Fluor 488 Imaging Kit Invitrogen Cat#C10337 Deposited Data Raw and analyzed RNA-seq data This paper GSE112886 (Continued on next page) Cell Stem Cell 23, 501–515.e1–e7, October 4, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: H1 ES cells (passage 42) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: H9 ES cells (passage 30) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0062 Human: iPS65.8 iPS cells (passage 44) CCHMC Pluripotent Stem cell core N/A Human: iPS72.3 iPS cells (passage 35) CCHMC Pluripotent Stem cell core N/A Human: iPS263.10 iPS cells (passage 30) N/A N/A Human: WTC CRISPRi-SOX2 iPS cells (passage 43) Conklin lab Mandegar et al., 2016 Experimental Models: Organisms/Strains Mouse: Foxa2tm2.1(cre/Esr1*)Moon/J The Jackson Laboratory JAX: 008464 Mouse: B6;129S-Sox2tm1(cre/ERT2)Hoch/J The Jackson Laboratory JAX: 017593 Mouse: Sox2tm1.1Lan/J Lang Lab (JAX: 013093) Xenopus laevis N/A N/A Oligonucleotides sox2- UTR MO: CTGGCAGAGCGGAATCAGTTTCCCA GeneTools N/A (synthesized) sox2- ATG MO: AGCTCGGTCTCCATCATGCTGTAC GeneTools N/A (synthesized) control MO: CCTCTTACCTCAGTTACAATTTATA GeneTools N/A (synthesized) See Table S1 for qRT-PCR primers IDT DNA N/A (synthesized) Recombinant DNA pINDUCER20 Meerbrey et al., 2011 Addgene plasmid 44012 Software and Algorithms Imaris Bitplane N/A NIS Elements Nikon N/A Computational Suite for Bioinformaticians and Biologists version 2.1 (CSBB v2.1) N/A https://sourceforge.net/projects/ csbb-v2-1/ Gene Set Enrichment Analysis (GSEA) N/A Subramanian et al., 2005 PRISMv6 graphing and statistical software GraphPad Software N/A ..

    Quantitative RT-PCR:

    Article Title: Esophageal Organoids from Human Pluripotent Stem Cells Delineate Sox2 Functions during Esophageal Specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Activin A Cell Guidance Systems Cat#GFH6 CHIR99021 Stemgent Cat#04-0004 BIO Tocris Cat#3194 Y-27632 dihydrochloride Tocris Cat#1254 SB431542 Tocris Cat#1614 Doxycycline Sigma-Aldrich Cat#D3447 Tamoxifen Sigma-Aldrich Cat#T5648 hESC-qualified Matrigel BD Biosciences Cat#354277 mTeSR1 media Stem Cell Technologies Cat#5850 Advanced DMEM:F12 Thermo Fisher Scientfic Cat#12634-010 Matrigel BD Biosciences Cat#354234 Defined fetal bovine serum (dFBS) Hyclone Cat#SH30070.02 Proteinase K Thermo Fisher Scientifc Cat#AM2548 Normal donkey serum Jackson Immunoresearch Labs Cat#017-000-121 Heat-inactivated lamb serum GIBCO Cat#16070096 Blocking Reagent Sigma-Aldrich Cat#11096176001 L-glutamine (100x) Thermo Fisher Scientific Cat#25030-081 Pen/Strep (100x) Thermo Fisher Scientific Cat#15140-122 50x B27 supplement w/o Vitamin A Thermo Fisher Scientific Cat#12587-010 Non-essential Amino Acids (100x) Thermo Fisher Scientific Cat#11140050 HEPES Buffer Thermo Fisher Scientific Cat#15630080 N2 Supplement Thermo Fisher Scientific Cat#17502-048 Dispase Thermo Fisher Scientific Cat#17105-041 Acutase Thermo Fisher Scientific Cat#A11105-01 Collagen Type I, rat tail EMD Millipore Cat#08-115 Transwell 24mm Polyester Membrane Inserts, 6 well plate Corning Cat#3450 Deep Well Plate, 6 well BD Cat#355467 Ahlstrom Filter Papers – Grade 222 Fisher Scientific Cat#09-790-49J 1,2-Dioctanoyl-sn-glycerol Cayman Chemicals Cat#62225 F12 Media Invitrogen Cat#11765-054 1x DMEM Invitrogen Cat#11965-084 Fetal Bovine Serum (FBS) HyClone Cat#SH30071.03 Adenine Sigma-Aldrich Cat#A2786-5G Cholera toxin EMD Millipore Cat#227035 Hydrocortisone Sigma-Aldrich Cat#H0888-1G Fungizone (Amphotericin B) Omega Scientific Cat#FG-70 Insulin, human recombinant Invitrogen Cat#12585-014 EGF Sigma-Aldrich Cat#1257-0.1MG RNAlater Thermo Fisher Scientific Cat#AM7020 Critical Commercial Assays Quantitect SYBR Green QIAGEN Cat#204145 Nucleospin RNA Macherey-Nagel Cat#740955 SuperScript VILO cDNA synthesis kit Thermo Fisher Scientific Cat#11754250 Click-iT EdU Alexa Fluor 488 Imaging Kit Invitrogen Cat#C10337 Deposited Data Raw and analyzed RNA-seq data This paper GSE112886 (Continued on next page) Cell Stem Cell 23, 501–515.e1–e7, October 4, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: H1 ES cells (passage 42) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: H9 ES cells (passage 30) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0062 Human: iPS65.8 iPS cells (passage 44) CCHMC Pluripotent Stem cell core N/A Human: iPS72.3 iPS cells (passage 35) CCHMC Pluripotent Stem cell core N/A Human: iPS263.10 iPS cells (passage 30) N/A N/A Human: WTC CRISPRi-SOX2 iPS cells (passage 43) Conklin lab Mandegar et al., 2016 Experimental Models: Organisms/Strains Mouse: Foxa2tm2.1(cre/Esr1*)Moon/J The Jackson Laboratory JAX: 008464 Mouse: B6;129S-Sox2tm1(cre/ERT2)Hoch/J The Jackson Laboratory JAX: 017593 Mouse: Sox2tm1.1Lan/J Lang Lab (JAX: 013093) Xenopus laevis N/A N/A Oligonucleotides sox2- UTR MO: CTGGCAGAGCGGAATCAGTTTCCCA GeneTools N/A (synthesized) sox2- ATG MO: AGCTCGGTCTCCATCATGCTGTAC GeneTools N/A (synthesized) control MO: CCTCTTACCTCAGTTACAATTTATA GeneTools N/A (synthesized) See Table S1 for qRT-PCR primers IDT DNA N/A (synthesized) Recombinant DNA pINDUCER20 Meerbrey et al., 2011 Addgene plasmid 44012 Software and Algorithms Imaris Bitplane N/A NIS Elements Nikon N/A Computational Suite for Bioinformaticians and Biologists version 2.1 (CSBB v2.1) N/A https://sourceforge.net/projects/ csbb-v2-1/ Gene Set Enrichment Analysis (GSEA) N/A Subramanian et al., 2005 PRISMv6 graphing and statistical software GraphPad Software N/A ..

    Recombinant:

    Article Title: Esophageal Organoids from Human Pluripotent Stem Cells Delineate Sox2 Functions during Esophageal Specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Activin A Cell Guidance Systems Cat#GFH6 CHIR99021 Stemgent Cat#04-0004 BIO Tocris Cat#3194 Y-27632 dihydrochloride Tocris Cat#1254 SB431542 Tocris Cat#1614 Doxycycline Sigma-Aldrich Cat#D3447 Tamoxifen Sigma-Aldrich Cat#T5648 hESC-qualified Matrigel BD Biosciences Cat#354277 mTeSR1 media Stem Cell Technologies Cat#5850 Advanced DMEM:F12 Thermo Fisher Scientfic Cat#12634-010 Matrigel BD Biosciences Cat#354234 Defined fetal bovine serum (dFBS) Hyclone Cat#SH30070.02 Proteinase K Thermo Fisher Scientifc Cat#AM2548 Normal donkey serum Jackson Immunoresearch Labs Cat#017-000-121 Heat-inactivated lamb serum GIBCO Cat#16070096 Blocking Reagent Sigma-Aldrich Cat#11096176001 L-glutamine (100x) Thermo Fisher Scientific Cat#25030-081 Pen/Strep (100x) Thermo Fisher Scientific Cat#15140-122 50x B27 supplement w/o Vitamin A Thermo Fisher Scientific Cat#12587-010 Non-essential Amino Acids (100x) Thermo Fisher Scientific Cat#11140050 HEPES Buffer Thermo Fisher Scientific Cat#15630080 N2 Supplement Thermo Fisher Scientific Cat#17502-048 Dispase Thermo Fisher Scientific Cat#17105-041 Acutase Thermo Fisher Scientific Cat#A11105-01 Collagen Type I, rat tail EMD Millipore Cat#08-115 Transwell 24mm Polyester Membrane Inserts, 6 well plate Corning Cat#3450 Deep Well Plate, 6 well BD Cat#355467 Ahlstrom Filter Papers – Grade 222 Fisher Scientific Cat#09-790-49J 1,2-Dioctanoyl-sn-glycerol Cayman Chemicals Cat#62225 F12 Media Invitrogen Cat#11765-054 1x DMEM Invitrogen Cat#11965-084 Fetal Bovine Serum (FBS) HyClone Cat#SH30071.03 Adenine Sigma-Aldrich Cat#A2786-5G Cholera toxin EMD Millipore Cat#227035 Hydrocortisone Sigma-Aldrich Cat#H0888-1G Fungizone (Amphotericin B) Omega Scientific Cat#FG-70 Insulin, human recombinant Invitrogen Cat#12585-014 EGF Sigma-Aldrich Cat#1257-0.1MG RNAlater Thermo Fisher Scientific Cat#AM7020 Critical Commercial Assays Quantitect SYBR Green QIAGEN Cat#204145 Nucleospin RNA Macherey-Nagel Cat#740955 SuperScript VILO cDNA synthesis kit Thermo Fisher Scientific Cat#11754250 Click-iT EdU Alexa Fluor 488 Imaging Kit Invitrogen Cat#C10337 Deposited Data Raw and analyzed RNA-seq data This paper GSE112886 (Continued on next page) Cell Stem Cell 23, 501–515.e1–e7, October 4, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: H1 ES cells (passage 42) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: H9 ES cells (passage 30) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0062 Human: iPS65.8 iPS cells (passage 44) CCHMC Pluripotent Stem cell core N/A Human: iPS72.3 iPS cells (passage 35) CCHMC Pluripotent Stem cell core N/A Human: iPS263.10 iPS cells (passage 30) N/A N/A Human: WTC CRISPRi-SOX2 iPS cells (passage 43) Conklin lab Mandegar et al., 2016 Experimental Models: Organisms/Strains Mouse: Foxa2tm2.1(cre/Esr1*)Moon/J The Jackson Laboratory JAX: 008464 Mouse: B6;129S-Sox2tm1(cre/ERT2)Hoch/J The Jackson Laboratory JAX: 017593 Mouse: Sox2tm1.1Lan/J Lang Lab (JAX: 013093) Xenopus laevis N/A N/A Oligonucleotides sox2- UTR MO: CTGGCAGAGCGGAATCAGTTTCCCA GeneTools N/A (synthesized) sox2- ATG MO: AGCTCGGTCTCCATCATGCTGTAC GeneTools N/A (synthesized) control MO: CCTCTTACCTCAGTTACAATTTATA GeneTools N/A (synthesized) See Table S1 for qRT-PCR primers IDT DNA N/A (synthesized) Recombinant DNA pINDUCER20 Meerbrey et al., 2011 Addgene plasmid 44012 Software and Algorithms Imaris Bitplane N/A NIS Elements Nikon N/A Computational Suite for Bioinformaticians and Biologists version 2.1 (CSBB v2.1) N/A https://sourceforge.net/projects/ csbb-v2-1/ Gene Set Enrichment Analysis (GSEA) N/A Subramanian et al., 2005 PRISMv6 graphing and statistical software GraphPad Software N/A ..

    Plasmid Preparation:

    Article Title: Esophageal Organoids from Human Pluripotent Stem Cells Delineate Sox2 Functions during Esophageal Specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Activin A Cell Guidance Systems Cat#GFH6 CHIR99021 Stemgent Cat#04-0004 BIO Tocris Cat#3194 Y-27632 dihydrochloride Tocris Cat#1254 SB431542 Tocris Cat#1614 Doxycycline Sigma-Aldrich Cat#D3447 Tamoxifen Sigma-Aldrich Cat#T5648 hESC-qualified Matrigel BD Biosciences Cat#354277 mTeSR1 media Stem Cell Technologies Cat#5850 Advanced DMEM:F12 Thermo Fisher Scientfic Cat#12634-010 Matrigel BD Biosciences Cat#354234 Defined fetal bovine serum (dFBS) Hyclone Cat#SH30070.02 Proteinase K Thermo Fisher Scientifc Cat#AM2548 Normal donkey serum Jackson Immunoresearch Labs Cat#017-000-121 Heat-inactivated lamb serum GIBCO Cat#16070096 Blocking Reagent Sigma-Aldrich Cat#11096176001 L-glutamine (100x) Thermo Fisher Scientific Cat#25030-081 Pen/Strep (100x) Thermo Fisher Scientific Cat#15140-122 50x B27 supplement w/o Vitamin A Thermo Fisher Scientific Cat#12587-010 Non-essential Amino Acids (100x) Thermo Fisher Scientific Cat#11140050 HEPES Buffer Thermo Fisher Scientific Cat#15630080 N2 Supplement Thermo Fisher Scientific Cat#17502-048 Dispase Thermo Fisher Scientific Cat#17105-041 Acutase Thermo Fisher Scientific Cat#A11105-01 Collagen Type I, rat tail EMD Millipore Cat#08-115 Transwell 24mm Polyester Membrane Inserts, 6 well plate Corning Cat#3450 Deep Well Plate, 6 well BD Cat#355467 Ahlstrom Filter Papers – Grade 222 Fisher Scientific Cat#09-790-49J 1,2-Dioctanoyl-sn-glycerol Cayman Chemicals Cat#62225 F12 Media Invitrogen Cat#11765-054 1x DMEM Invitrogen Cat#11965-084 Fetal Bovine Serum (FBS) HyClone Cat#SH30071.03 Adenine Sigma-Aldrich Cat#A2786-5G Cholera toxin EMD Millipore Cat#227035 Hydrocortisone Sigma-Aldrich Cat#H0888-1G Fungizone (Amphotericin B) Omega Scientific Cat#FG-70 Insulin, human recombinant Invitrogen Cat#12585-014 EGF Sigma-Aldrich Cat#1257-0.1MG RNAlater Thermo Fisher Scientific Cat#AM7020 Critical Commercial Assays Quantitect SYBR Green QIAGEN Cat#204145 Nucleospin RNA Macherey-Nagel Cat#740955 SuperScript VILO cDNA synthesis kit Thermo Fisher Scientific Cat#11754250 Click-iT EdU Alexa Fluor 488 Imaging Kit Invitrogen Cat#C10337 Deposited Data Raw and analyzed RNA-seq data This paper GSE112886 (Continued on next page) Cell Stem Cell 23, 501–515.e1–e7, October 4, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: H1 ES cells (passage 42) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: H9 ES cells (passage 30) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0062 Human: iPS65.8 iPS cells (passage 44) CCHMC Pluripotent Stem cell core N/A Human: iPS72.3 iPS cells (passage 35) CCHMC Pluripotent Stem cell core N/A Human: iPS263.10 iPS cells (passage 30) N/A N/A Human: WTC CRISPRi-SOX2 iPS cells (passage 43) Conklin lab Mandegar et al., 2016 Experimental Models: Organisms/Strains Mouse: Foxa2tm2.1(cre/Esr1*)Moon/J The Jackson Laboratory JAX: 008464 Mouse: B6;129S-Sox2tm1(cre/ERT2)Hoch/J The Jackson Laboratory JAX: 017593 Mouse: Sox2tm1.1Lan/J Lang Lab (JAX: 013093) Xenopus laevis N/A N/A Oligonucleotides sox2- UTR MO: CTGGCAGAGCGGAATCAGTTTCCCA GeneTools N/A (synthesized) sox2- ATG MO: AGCTCGGTCTCCATCATGCTGTAC GeneTools N/A (synthesized) control MO: CCTCTTACCTCAGTTACAATTTATA GeneTools N/A (synthesized) See Table S1 for qRT-PCR primers IDT DNA N/A (synthesized) Recombinant DNA pINDUCER20 Meerbrey et al., 2011 Addgene plasmid 44012 Software and Algorithms Imaris Bitplane N/A NIS Elements Nikon N/A Computational Suite for Bioinformaticians and Biologists version 2.1 (CSBB v2.1) N/A https://sourceforge.net/projects/ csbb-v2-1/ Gene Set Enrichment Analysis (GSEA) N/A Subramanian et al., 2005 PRISMv6 graphing and statistical software GraphPad Software N/A ..

    Software:

    Article Title: Esophageal Organoids from Human Pluripotent Stem Cells Delineate Sox2 Functions during Esophageal Specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Activin A Cell Guidance Systems Cat#GFH6 CHIR99021 Stemgent Cat#04-0004 BIO Tocris Cat#3194 Y-27632 dihydrochloride Tocris Cat#1254 SB431542 Tocris Cat#1614 Doxycycline Sigma-Aldrich Cat#D3447 Tamoxifen Sigma-Aldrich Cat#T5648 hESC-qualified Matrigel BD Biosciences Cat#354277 mTeSR1 media Stem Cell Technologies Cat#5850 Advanced DMEM:F12 Thermo Fisher Scientfic Cat#12634-010 Matrigel BD Biosciences Cat#354234 Defined fetal bovine serum (dFBS) Hyclone Cat#SH30070.02 Proteinase K Thermo Fisher Scientifc Cat#AM2548 Normal donkey serum Jackson Immunoresearch Labs Cat#017-000-121 Heat-inactivated lamb serum GIBCO Cat#16070096 Blocking Reagent Sigma-Aldrich Cat#11096176001 L-glutamine (100x) Thermo Fisher Scientific Cat#25030-081 Pen/Strep (100x) Thermo Fisher Scientific Cat#15140-122 50x B27 supplement w/o Vitamin A Thermo Fisher Scientific Cat#12587-010 Non-essential Amino Acids (100x) Thermo Fisher Scientific Cat#11140050 HEPES Buffer Thermo Fisher Scientific Cat#15630080 N2 Supplement Thermo Fisher Scientific Cat#17502-048 Dispase Thermo Fisher Scientific Cat#17105-041 Acutase Thermo Fisher Scientific Cat#A11105-01 Collagen Type I, rat tail EMD Millipore Cat#08-115 Transwell 24mm Polyester Membrane Inserts, 6 well plate Corning Cat#3450 Deep Well Plate, 6 well BD Cat#355467 Ahlstrom Filter Papers – Grade 222 Fisher Scientific Cat#09-790-49J 1,2-Dioctanoyl-sn-glycerol Cayman Chemicals Cat#62225 F12 Media Invitrogen Cat#11765-054 1x DMEM Invitrogen Cat#11965-084 Fetal Bovine Serum (FBS) HyClone Cat#SH30071.03 Adenine Sigma-Aldrich Cat#A2786-5G Cholera toxin EMD Millipore Cat#227035 Hydrocortisone Sigma-Aldrich Cat#H0888-1G Fungizone (Amphotericin B) Omega Scientific Cat#FG-70 Insulin, human recombinant Invitrogen Cat#12585-014 EGF Sigma-Aldrich Cat#1257-0.1MG RNAlater Thermo Fisher Scientific Cat#AM7020 Critical Commercial Assays Quantitect SYBR Green QIAGEN Cat#204145 Nucleospin RNA Macherey-Nagel Cat#740955 SuperScript VILO cDNA synthesis kit Thermo Fisher Scientific Cat#11754250 Click-iT EdU Alexa Fluor 488 Imaging Kit Invitrogen Cat#C10337 Deposited Data Raw and analyzed RNA-seq data This paper GSE112886 (Continued on next page) Cell Stem Cell 23, 501–515.e1–e7, October 4, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: H1 ES cells (passage 42) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: H9 ES cells (passage 30) CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0062 Human: iPS65.8 iPS cells (passage 44) CCHMC Pluripotent Stem cell core N/A Human: iPS72.3 iPS cells (passage 35) CCHMC Pluripotent Stem cell core N/A Human: iPS263.10 iPS cells (passage 30) N/A N/A Human: WTC CRISPRi-SOX2 iPS cells (passage 43) Conklin lab Mandegar et al., 2016 Experimental Models: Organisms/Strains Mouse: Foxa2tm2.1(cre/Esr1*)Moon/J The Jackson Laboratory JAX: 008464 Mouse: B6;129S-Sox2tm1(cre/ERT2)Hoch/J The Jackson Laboratory JAX: 017593 Mouse: Sox2tm1.1Lan/J Lang Lab (JAX: 013093) Xenopus laevis N/A N/A Oligonucleotides sox2- UTR MO: CTGGCAGAGCGGAATCAGTTTCCCA GeneTools N/A (synthesized) sox2- ATG MO: AGCTCGGTCTCCATCATGCTGTAC GeneTools N/A (synthesized) control MO: CCTCTTACCTCAGTTACAATTTATA GeneTools N/A (synthesized) See Table S1 for qRT-PCR primers IDT DNA N/A (synthesized) Recombinant DNA pINDUCER20 Meerbrey et al., 2011 Addgene plasmid 44012 Software and Algorithms Imaris Bitplane N/A NIS Elements Nikon N/A Computational Suite for Bioinformaticians and Biologists version 2.1 (CSBB v2.1) N/A https://sourceforge.net/projects/ csbb-v2-1/ Gene Set Enrichment Analysis (GSEA) N/A Subramanian et al., 2005 PRISMv6 graphing and statistical software GraphPad Software N/A ..



    Similar Products

    2011 addgene plasmid 44012 software  (Oxford Instruments)
    99
    Oxford Instruments 2011 addgene plasmid 44012 software
    2011 Addgene Plasmid 44012 Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2011+addgene+plasmid+44012+software/Imaris/pm30244869-237-152-159
    Average 99 stars, based on 1 article reviews
    2011 addgene plasmid 44012 software - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    2011 addgene plasmid 44012 software  (Addgene inc)
    96
    Addgene inc 2011 addgene plasmid 44012 software
    2011 Addgene Plasmid 44012 Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2011+addgene+plasmid+44012+software/pInducer20+(Plasmid+%2344012)/pm30244869-237-152-153
    Average 96 stars, based on 1 article reviews
    2011 addgene plasmid 44012 software - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results